平台编号：Bio-110580

Deposited As Aspergillus flavus Link

Strain Designations M001 [CBS 260.67, DSM 2038, IFO 30179, IMI 120920, TPI]

Application 

Produces 4,4'-dihydroxybiphenyl

Produces aflatoxin B1 aflatoxin B

Produces aflatoxin B2

Produces aflatoxin G1

Produces aflatoxin G2

Produces aflatoxins

Produces versiconal acetate

Transforms sesquiterpene lactone costunolide

Converts averufin into aflatoxins

Converts (14C) sterigmatocystin into aflatoxin B1

Challenge organism for testing inhibition of mycotoxin production with dialkyl enol phosphate

Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried

Storage Conditions Frozen: -80°C or colder

Freeze-Dried: 2°C to 8°C

Live Culture: See Propagation Section

Type Strain yes (type strain of Aspergillus parasiticus var. globosus)Preceptrol® no

Comments 

Rat colon carcinomas

Medium ATCC® Medium 312: Czapek's agar

ATCC® Medium 336: Potato dextrose agar (PDA)

ATCC® Medium 325: Malt extract agar (Blakeslee's formula)

Growth Conditions 

Temperature: 24°C to 26°C

Atmosphere: Typical aerobic

Sequenced Data 

18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCGTCATGGCCGCCGGGGGCGTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAAC

TCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAG

TCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCG

TCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAAACAACCATTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG

D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCTGTC

TAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAAT

ACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCTCCAGGGTTCAGCCGGCATTCGTGCC

GGTGTACTTCCCTGGGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCTCCCGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCGGGAGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTG

GCATAATGGTCGTAAACGA

Calmodulin gene, partial sequence

GTTTATCAAGTTTCTGTTCGATCGGCTGAAGTCTTGGCATTGATGAATTGACTTGATATGCAGGCCAGATCACCACCAAGGAGTTGGGCACTGTCATGCGCTCTCTGGGTCAAAACCCCTCTGAGTCGGAACTCCAGGACATG

ATTAACGAGGTTGACGCCGACAACAATGGCACCATTGACTTCCCTGGTACGAGACGGCTTCGTACGATTCATAAATGAAATAGTTGTTAATCGTCCAAATAGAATTCCTTACCATGATGGCC

Name of Depositor RI Mateles

Chain of Custody 

ATCC <-- RI Mateles <-- Tropical Products Inst. strain TPI

References 

Reddy TV, et al. Factors affecting aflatoxin production by Aspergillus parasiticus in a chemically defined medium. J. Gen. Microbiol. 114: 409-413, 1979. PubMed: 541661

Golbeck JH, Cox JC. The hydroxylation of biphenyl by Aspergillus toxicarius: conditions for a bench scale fermentation process. Biotechnol. Bioeng. 26: 434-441, 1984.

Leary JS. Methods of controlling mycotoxin production using certain dialkyl enol phosphates. US Patent 3,798,323 dated Mar 19 1974

. . J. Gen. Appl. Microbiol. 12: 195, 1966.

Newberne PM, Rogers AE. Rat colon carcinomas associated with aflatoxin and marginal vitamin A. J. Natl. Cancer Inst. 50: 439-448, 1973. PubMed: 4702116

Clark AM, Hufford CD. Microbial transformations of the sesquiterpene lactone costunolide. J. Chem. Soc. Perkin Trans. 1979: 3022-3028, 1979.

Steyn PS, et al. Structure and carbon-13 nuclear magnetic resonance assignments of versiconal acetate, versiconol acetate, and versiconol, metabolites from cultures of Aspergillus parasiticus treated with dichlorvos. J. Chem. Soc. Perkin Trans. 1979: 451-459, 1979.

Steyn PS, et al. Biosynthesis of versiconal acetate, versiconol acetate, and versiconol, metabolites from cultures of Aspergillus parasiticus treated with dichlorvos. The role of versiconal acetate in aflatoxin biosynthesis. J. Chem. Soc. Perkin Trans. 1979: 460-463, 1979.

Wei DL, Jong SC. Production of aflatoxins by strains of the Aspergillus flavus group maintained in ATCC. Mycopathologia 93: 19-24, 1986. PubMed: 3083260

Adye J, Mateles RI. Incorporation of labelled compounds into aflatoxins. Biochim. Biophys. Acta 86: 418-420, 1964.

Lin MT, et al. Conversion of averufin into aflatoxins by Aspergillus parasiticus. Biochemistry 12: 5167-5171, 1973. PubMed: 4792300

Singh R, Hsieh DP. Enzymatic conversion of sterigmatocystin into aflatoxin B1 by cell-free extracts of Aspergillus parasiticus. Appl. Environ. Microbiol. 31: 743-745, 1976. PubMed: 5954

type strain of Aspergillus parasiticus var. globosus

type strain of Aspergillus parasiticus var. globosus